string help :(

[Djvk92yv]

.

[TarikNeaj]

Didnt you already ask this exact question yesterday? You got answers there.

[Djvk92yv]

.

[TarikNeaj]

string is part of the std::, so is cout and cin So you are using it all the time. std is just the standard library in c++ and you use it all the time.

[Djvk92yv]

.

[TarikNeaj]

You could do something like this -

char seq[12] = { 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G' };
std::string protein[4] = { "ATC", "GAT", "CGA", "TCG" };
	
protein[0].assign(seq, 3);

std::cout << protein[0] << std::endl;

You see this - protein[0].assign(seq, 3); The number 3 is how many characters from the char array you want to put in the protein[0]. So if you change from number 3 to say, 5. and print out protein[0] You will get

ATCG

[Djvk92yv]

.

[TarikNeaj]

I spefically told you.

The number 3 is how many characters from the char array you want to put in the protein[0]. So if you change from number 3 to say, 5. and print out protein[0] You will get
ATCG

If you want everything to come out, you change the number 3, to number 12.

protein[0].assign(seq, 12);

[Djvk92yv]

.

[TarikNeaj]

You never said that. Now you're saying you just want to print out the string array?

for (int i = 0; i < 4; i++)
{
	std::cout << protein[i] << " ";
}

[Djvk92yv]

.

[TarikNeaj]

This -

for (int i = 0; i < 4; i++)
{
	std::cout << protein[i] << " ";
}

Does NOT only show ATC. It shows everything.

ATC GAT CGA TCG

I wont further respond to this thread unless you have a qustion that I can understand.

[Djvk92yv]

.

[TarikNeaj]

Now all of a sudden your string array is empty?..................

Im gonna quote myself quoting myself here -

I spefically told you.

The number 3 is how many characters from the char array you want to put in the protein[0]. So if you change from number 3 to say, 5. and print out protein[0] You will get
ATCG


If you want everything to come out, you change the number 3, to number 12.

protein[0].assign(seq, 12);

Change the 3, to 12.

And you dont need a string array, you only need one string.

char seq[12] = { 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G' };
string protein;

protein.assign(seq, 12);

std::cout << protein;
	

[SECMoG1T]

i would use a vector of strings :D

template<std::size_t N>
std::vector<std::string> generate_sequences(char(&array)[N])
 {
      std::vector<std::string> seq;
      std::size_t pos=0;

      while(pos<N)
       {
           seq.push_back(std::string(array,pos,3));
           pos+=3;
       }

 return seq;
 }
      
void print(std::vector<std::string>& vec)
{
    for(const auto& seq : vec)
         std::cout<<seq<<" ";
         std::cout<<"\n\n";
}

int main()
 {
     char seq[12] = { 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G' };///for input provided total  
                                                                                        ///bases value is divisible by three

  auto sequences=generate_sequences(seq);
  print(sequences);

  char seqptr[]="ATCGCCACTAAACGCATGGCACCCGAATCAGGGCGTCATTTAGCTTGACGAGCCCGGATACCGGAGTGCCGAAGT";
  auto seq2=generate_sequences(seqptr);

  print(seq2);
 
 return 0;
 }
       

[Djvk92yv]

.

[TarikNeaj]

Yeh @Andy... Lets not get too advanced here :)

[SECMoG1T]

@TarikNeaj the whole idea is the same only that i added a function with a template to help deduce the array size then pushes three bases into a vector as a string object, thats all

[TarikNeaj]

Which is not maybe advanced in and of itself, but relatively to this guy its advanced, you would know that if you read the thread.

[SECMoG1T]

Ooh yeh, i probably assumed everything but maybe we can simplify that to this judt to make sure the op understands

void generate_sequences(char arr[],int size,std::string result[])///result is an array large enough to hold all resulting strings
 {
      int pos=0,counter=0;
       while(pos<size)
       {
           std::string temp_seq(arr,pos,3);//this string constructor copies three characters from position pos in arr
           result[counter]=temp_seq;
           ++counter; pos+=3;///just increment pos by three each time
       }
 }

 void print(std::string arr[],int size)
{
   for(int i=0;i<size;i++)
   {
       std::cout<<arr[i]<<" ";
   }
}

int main()
 {
     char seq[12] = { 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G', 'A', 'T', 'C', 'G' };///for input provided total
                                                                                   ///bases value is divisible by three
     const int sz=12/3;
     std::string result[sz];

     generate_sequences(seq,12,result);
     print(result,sz);

     char seqptr[90]{'A','T','C','G','C','C','A','C','T','A','A','A','C','G','C','A','T',
                     'G','G','C','A','C','C','C','G','A','A','T','C','A','G','G','G','C',
                     'G','T','C','A','T','T','T','A','G','C','T','T','G','A','C','G','A',
                     'G','C','C','C','G','G','A','T','A','C','C','G','G','A','G','T','G',
                     'C','C','G','A','A','G','T','T','A','G','T','C','T','T','A','G','A',
                     'A','T','G','G','T'
                    };

     std::string result2[30];

     generate_sequences(seqptr,90,result2);

     print(result2,30);

 return 0;
 }