Beginners - December 2017 (Page 22)

Quick fix help, duplicate words and a few things
 
Hello, Could you please help me in fixing the following issues. Out putting only unique wor...
[7 replies] Last: For the longest name, go through the array TWICE. The first time shoul... (by lastchance)
advice on reading in data for a project
 
Write your question here. Hello, I am working on a little project that I hope to make an app for pe...
[1 reply] : I'd use a table. The more items you match on a given line the more li... (by SamuelAdams)
Help with text game please.
 
Hello, I am trying to code an adventure game for one of my classes, so far I have this. I have a que...
[5 replies] Last: Okay here is what I have now, I still am at a delima though for making... (by Brandon33310)
Dynamic Allocation
 
Why does my program print 1.000000 for each array element? #include <cstdio> const int MaxSiz...
[2 replies] Last: because you wrote the value in the function into the variable "fill" a... (by jonnin)
tracing the output
 
I fully understand the output for the first function calling but I don't understand the output for t...
[3 replies] Last: thanks, I was looking at it all wrong (by Ryoka117)
Timer along with a c++ program.
 
I intend to make a simple minesweeper i am done with the most part but i am stuck at one place. I wa...
[1 reply] : You can use this system: #include <ctime> //for time() int main() {... (by goldenchicken)
Queue - Store simulation , customer waiting time issue
 
I am trying to build a queue of customers in a store. all the variables are printing the appropriate...
[3 replies] Last: ok. what do you think it should print? is the value of waitingTime s... (by jonnin)
ASCII or Unicode
 
Sorry about the basic questions lately I've been taken quite a few steps back to make me a better pr...
[2 replies] Last: wow your right time for me to take a break if I'm making mistakes like... (by adam2016)
by Yertoo
C++ random video selector.
 
I'm trying to write a program that will select and open a .mkv file in vlc media player. I have been...
[6 replies] Last: No I had to remove the (" and ") from the beginning and end of each fi... (by Yertoo)
garbage values being printed out (1,2)
 
so I made a quick algorithm to check for duplicates and if it's detected don't add them to a new str...
[20 replies] Last: thanks jlb much appreciated =) (by adam2016)
Problem with simple calculation
 
I am a student in college and i have this first assignment to calculate netpay. the calculation of t...
[1 reply] : Hello Ayoub Hashemi, Welcome to the forum. Sorry for the delay, but ... (by Handy Andy)
I NEED BIG HELP FOR employee Absent project:
 
I have a running code here. should really do the trick. I am having trouble releasing the informat...
[2 replies] Last: Hello trazafin, The parts that needed fixed: The proto types: nt da... (by Handy Andy)
by darje
Recursion pseudo code
 
Write your question here. int A(int n) { if (n == 0) { // ...
[2 replies] Last: How can i see the algorithem in the debugger debuger in visual studio?... (by jonnin)
How do I keyboard input in OpenGL
 
Hello, I am trying to solve my OpenGL pyramid project. If anyone can please help me with a code a...
[1 reply] : Things you might try.. (3 is probably what you want) 1) gui, where p... (by jonnin)
scope
 
hi guys this a similar question to my array question but differs slightly so I said I'll open anothe...
[1 reply] : Hello adam2016, I am not saying I am the best at this, but I will giv... (by Handy Andy)
Trying to perform a swap to sort a vector
 
Hello, I'm having issues with a swap function to sort a vector from highest value to lowest or vi...
[1 reply] : Hello ritzbitz, Welcome to the forum. and thank you for using code ta... (by Handy Andy)
string problem
 
HI. I have string: TATAGAGCTAGCTAGCTAGCTAGCTAGC Is there easy way to look for line like GATA in str...
[3 replies] Last: You did ask for easy way. That is string::find() Note that there ar... (by keskiverto)
on filling a string array it stores from 1 index not 0 why
 
Write your question here. #include <iostream> #include<string> #include<vector> using names...
[6 replies] Last: it's specified that each line has a length of 25 If that is true, th... (by keskiverto)
Vectors
 
I have tried to run this program and every time that I do, it crashes. Do I have something wrong in ...
[6 replies] Last: Thanks @Chervil, @Thomas1965. Yes, fair comment: I shouldn't have let... (by lastchance)
December 2017 Pages: 1... 20212223
  Archived months: [nov2017] [jan2018]

This is an archived page. To post a new message, go to the current page.