Beginners (Page 38)

How do I keyboard input in OpenGL
 
Hello, I am trying to solve my OpenGL pyramid project. If anyone can please help me with a code a...
[1 reply] : Things you might try.. (3 is probably what you want) 1) gui, where p... (by jonnin)
scope
 
hi guys this a similar question to my array question but differs slightly so I said I'll open anothe...
[1 reply] : Hello adam2016, I am not saying I am the best at this, but I will giv... (by Handy Andy)
Trying to perform a swap to sort a vector
 
Hello, I'm having issues with a swap function to sort a vector from highest value to lowest or vi...
[1 reply] : Hello ritzbitz, Welcome to the forum. and thank you for using code ta... (by Handy Andy)
string problem
 
HI. I have string: TATAGAGCTAGCTAGCTAGCTAGCTAGC Is there easy way to look for line like GATA in str...
[3 replies] Last: You did ask for easy way. That is string::find() Note that there ar... (by keskiverto)
on filling a string array it stores from 1 index not 0 why
 
Write your question here. #include <iostream> #include<string> #include<vector> using names...
[6 replies] Last: it's specified that each line has a length of 25 If that is true, th... (by keskiverto)
Vectors
 
I have tried to run this program and every time that I do, it crashes. Do I have something wrong in ...
[6 replies] Last: Thanks @Chervil, @Thomas1965. Yes, fair comment: I shouldn't have let... (by lastchance)
Structures
 
Write your question here. I'm trying to work out the bugs in this program and feel as though I have...
[8 replies] Last: Why are you using a pointer and new without delete in that functio... (by Chervil)
files
 
Thanks!
[12 replies] Last: Please DON'T delete your question after getting your answer. It makes... (by MikeyBoy)
sscanf filtering the quotation mark ?
 
i normally use cin for having and input from the user but i found out that sscanf is alot more usefu...
[2 replies] Last: so the syntax of the terminator is [^ then the boundary \" then ] rig... (by zeroblank)
Copy constructor
 
I'm trying to wrap my head around copy constructors... class A { public: int x; }; i...
[1 reply] : http://en.cppreference.com/w/cpp/language/initialization "you wrap yo... (by keskiverto)
Help me with this task please
 
I have a task, write a program that inputs a number and prints out a series of stars, what the numbe...
[1 reply] : IF interest for learning equals none then GO TO https://www.assignm... (by Thomas1965)
Segmentation fault with previous on a linked list?
 
I am wondering why I am getting a seg fault within this loop. It crashes on the last for loop when i...
[3 replies] Last: Apparently my previous pointer was not set to anything. The only pla... (by Chervil)
Bubble Sort
 
Ok so i have a project that was designed to make us create a file with 50,000 integers between 0 and...
[1 reply] : There are algorithms and sample code for sorting on various websites, ... (by Chervil)
Pages: 1... 363738
  Archived months: [nov2017]

Cannot post in this page. To post a new message, go to the first page.